Structure-independent nucleotide sequence analysis.

نویسندگان
چکیده

برای دانلود باید عضویت طلایی داشته باشید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Structure-independent nucleotide sequence analysis.

Substitution of inosine for granosine in the nucleic acid fragments synthesized for the sequencing of RNA effectively prevents the formation of secondary structures during electrophoretic analysis. Consequently, the mobility of each fragment in the sequencing gel is a strict function of its molecular weight. Inosine substitution should markedly improve the resolution that can be obtained in the...

متن کامل

Nucleotide Sequence and Secondary Structure Analysis

The nucleotide sequence of the 4.5 S ribosomal RNA from Spinacia oleracea chloroplast has been determined to be H~AGAGAAGGUCACGGCGAGACGAGCCGUUUAUCAUUAC GAUAGGUGUCAAGUGGAAGUGCAGUGAUGUAUGCAGCUGAGGCAUCCUAACAGACCCACAGAC WGAACoH using rapid gel sequencing techniques. This RNA contains 106 nucleotides including an AGA sequence at the 5’-end not found in other chloroplast 4.5 S RNAs and a seven-nucle...

متن کامل

Nucleotide sequence analysis of the Second Internal Transcribed Spacer (ITS2) in Hyalomma anatolicum anatolicum in Iran

Ticks are important acarina that infest animals. They are obligatory blood sucker arthropods which economically impact cattle industry by reducing weight gain and production. Moreover, they are important vectors of viral, bacterial, rickettsial and parasitic pathogens infecting humans and animals. In view of the importance of Hyalomma anatolicum anatolicum in pathogen transmission, including Th...

متن کامل

Nodavirus coat protein imposes dodecahedral RNA structure independent of nucleotide sequence and length.

The nodavirus Flock house virus (FHV) has a bipartite, positive-sense RNA genome that is packaged into an icosahedral particle displaying T=3 symmetry. The high-resolution X-ray structure of FHV has shown that 10 bp of well-ordered, double-stranded RNA are located at each of the 30 twofold axes of the virion, but it is not known which portions of the genome form these duplex regions. The regula...

متن کامل

Nucleotide Sequence Analysis of S1 Gene among Iranian Avian Infectious Bronchitis Viruses Isolated during 2001-2002

Infectious bronchitis (IB) virus genome codes for four structural proteins, among which the S1 subunit of spike glycoprotein comprises the major epitopes to induce neutralizing antibodies. This study involved the comparison of the full S1 sequences of five IB viruses, namely two Massachusetts and three 793/B serotypes, isolated from IB outbreaks during 2001-2002, with all other Iranian an...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Proceedings of the National Academy of Sciences

سال: 1979

ISSN: 0027-8424,1091-6490

DOI: 10.1073/pnas.76.5.2232